Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST151551
Clone ID OST151551
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST151551
Sequence
ACTGAGATTGGAAACCTGGACGATTACTATCATTTTTACCACAGCAAGACCTTCAAGAGATCGACCTTGAGCAGCAGTGG
CCCCCACACCTTCCTCAGAATGGACCCACAGGTACACGCCTCCAGACAATGTTCCTTCCCGAGGCTGAGAGCATCCTGTT
TTGCCCTCCTCAAAGGAGACCATAATGGGTTTCTAGTCTCAAAAATTAATTTCTGTATTTACATTGGATACAAGGTAGCA
GAGATAGAGCAACATGTCACATCCACTAAATGCTCTCGATTTTTGTATTTTTATCAGACTTGAGAAAAATACTTGACTTT
AGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 73055086..73055409 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030513 (Pcsk6) proprotein convertase subtilisin/kexin type 6 Gene [Source:MGI Symbol;Acc:MGI:102897]

 
Come back to gene ENSMUSG00000030513


For any suggestions or comments, please send an email to unitrap@crg.es