Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU542
Clone ID RRU542
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU542
Sequence
CTTGACAACCAGCATGCCGAGATGGCACGTTTTGTGCCCTCCCCGCCTCCAAATTGCCTCAGTTACAAATCAGAGGGCAG
GCTTGGTGAGCAAGACTGGCAAGCACATTTTAAGGTCCCGTGCTGTGGGGTTGATCCATCTCAACTTGAGTCAGAAGAGG
CAGAAGTGGATGTGAGAGAAAGAGACACACAGAGAGACAGAGAGCCAAAGAGGGCAAGAGACTTGACTTTAAGAG
Sequence Type mRNA
Unitrap ID UNI7204

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84192225..84201809 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es