Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU544
Clone ID RRU544
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU544
Sequence
TCCCCGGGCGGCGGCAGCTCCAAGATGGCGCAGGCGATCTTCGAGGCCCTGGAGGGAATGGACAATCAAACGGTTCTGGC
CGTCCAGTCCTTACTGGATGGCCAAGGAGCAGTCCCTGACCCCACAGGACAAAGTGTAAATGCGCCACCTGCCATCCAGC
CACTGGATGACGAGGATGTCTTTCTCTGCGGGAAGTGTAAAAAGCAGTTCAACTCACTGCCAGCCTTCATGACCCACAAG
CGTGAACAGTGCCAGGCAAACGCCCCTGCCCTGGCCACAGTCTCGCTGGCTACCAACAGCATCTATACACCGTCAGCAGC
ACCCGCTGCCGTCCAGCAGGCCCCACCTCCTGCCAACCG
Sequence Type mRNA
Unitrap ID UNI7206

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154439084..154450783 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059842 (Zfp341) NM_199304 zinc finger protein 341 Gene [Source:MGI (curated);Acc:Zfp341-001]

 
Come back to gene ENSMUSG00000059842


For any suggestions or comments, please send an email to unitrap@crg.es