Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST151066
Clone ID OST151066
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST151066
Sequence
ACTGAGACCCCTTTGCTGATGCAAGTAAGGGTGATGACCTGCTTCCTGCTGGCACTGAGGATTATATCCATATAAGAATT
CAACAGAGAAACGGCAGGAAGACCCTTACCACTGTCCAAGGGATCGCTGATGATTACCGATAAAAAGAAACTAGTGAAGG
CGTTTAAGAAGAAATTTGCCTGCAATGGTACTGTAATTGAGCATCCAGAATATGGAGAAGTAATTCAGCTACAGGGTGAC
CAGCGCAAGAACATATGCCAGTTCCTGATAGAGATTGGGCTGGCTAAGGACGATCAGCTGAAGGTTCATGGGTTTTAAGT
GCTTGTGGCTCTCTGAAGCTTAAGTGAGGATTTCCTTGCAATGAGTAGAATTTCNCTTCTGTCCCTTGTCACAAGTTTAA
AAACCTCACAGCTTGTATAATGTAATCATTTGGGGTCCGCTTTTAACTTGGACTAGTGTAACTCCTTCATGCAATAAACT
GAAAAGAGCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100181978..100182848 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035530 (Eif1) NM_011508 eukaryotic translation initiation factor 1 Gene [Source:MGI (curated);Acc:Eif1-001]

 
Come back to gene ENSMUSG00000035530


For any suggestions or comments, please send an email to unitrap@crg.es