Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU568
Clone ID RRU568
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU568
Sequence
TGTCAGTGTGGAGGAGACTGAGTATTCTTCCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACGTCGGTGGGC
ACTAACCGAGCCCGGGGAAACTGGGAACAACCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGCCACTGC
AGAGCAAATTCGACTTGCACAGATGATTTCGGACCATAATGATGCTGACTTTGAGGAGAAGGTGAAACAATTGATTGATA
TCACAGGCAAAAACCAGGATGAATGTGTGATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAG
Sequence Type mRNA
Unitrap ID UNI7210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89847657..89856398 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es