Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST150792
Clone ID OST150792
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST150792
Sequence
CCCAAATCTAGACCAAAGACACNATGCACTANCAGACATACTCGAAGCTAGAGACTGGAGATCTGGGGTCTTTNGTCCTT
CCTCAAACTGATTTTGCAGCCACCGGAGAGGAAGGGGAGATGGAAGGTGAGGCGGTTGAAGCCATTGTGGAGGAGTCTGA
AACTTTCATTAAATGAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108167424..108187726 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es