Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST150445
Clone ID OST150445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST150445
Sequence
ACTGAGGTTTGAGGGAGACAGTGTGGTCTCCTGGNTTAGAGCTGCTGCAGAAACTCTTCCTGTTTCAAAAATGTTGGAGG
AAGATATGGAAGTGGCCATCAAGATGGTGGTGGTGGGGAATGGGGCCGGTTGNAAAGTCCAGCATGATTCAGCGCTACTG
CAAAGGCATTTTCACAAAAGACTACAAGAAAACCATCNNGCGGTANACTTTTTGGAGCGACAGATTCAGTTTTTTTTCTT
CC
Sequence Type mRNA
Unitrap ID UNI25932

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33780629..33780852 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004768 (Rab23) NM_008999 RAB23, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab23-001]

 
Come back to gene ENSMUSG00000004768


For any suggestions or comments, please send an email to unitrap@crg.es