Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST150303
Clone ID OST150303
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST150303
Sequence
GACTGAGGCTCAAAGTCCTTATCTTCCCCACTATGGAGGAGTAGATGTCCACTTCTCAGGAGCAGCTGACTGCTTCCGGC
AGATCGTGAAAACCCAAGGGGTACTGGGGCTCTGGAACGGACTGACGGCTAACTTACTAAAGGTAGTTCCATATTTTGGA
GTTATGTTTAGCATGTTTGAGTTCTGTAAGAGAATTTTTCTTTATCAAAATGGTTACACCCTGTCCCCACTGACCTATAA
GGNGGNCCCCAGGAGTGGACCAAAGTTTGAAGCCCCAGGAATTACGGGAGCTAAAGAAGTTCTTCAAACGCAGAAAACTG
CACTCCAAAACACCACCTTGGTAAATAAAGCTGACTAGAACTACA
Sequence Type mRNA
Unitrap ID UNI13451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34315475..34317218 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037636 (Slc25a43) NM_001085497 solute carrier family 25, member 43 Gene [Source:MGI (curated);Acc:Slc25a43-001]

 
Come back to gene ENSMUSG00000037636


For any suggestions or comments, please send an email to unitrap@crg.es