Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST150171
Clone ID OST150171
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST150171
Sequence
TGGAGAGCCAGCTACAGAGGAGGAAATGACAGGAAAGATTGGAACAGTGACTGAAGAGTCCGGCAGCCTTGAGGAGGATG
TTCCCCATGACTCCAGAGGCAAAGAATTCCGTGAATTTGGAGAAGAATTGAACGATCAGATGCTTTTCAGAAGAAGACAG
TATAACTGTGATGAATGTGACCAAAGCTTTGCTTGGAGTACAGGTCTCATTAGGCNCCAAAGAACTCATTGGAAACCTTA
CGAATGTGAGGAATGTGGAAAGGCCTTTCGGATGAGCTCAGCCCTGGTTCTGCATCAGAGAATTCATACTGGAGAGAAGC
CCTATCCTTGNAGTTGGNGTATTAAAAGTTTTAGTCGGAGCTCAGACCTTATTAAACATCAAAAGAGGNCCACCACTGGG
GGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24161173..24519133 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063281 (Zfp35) NM_011755 zinc finger protein 35 Gene [Source:MGI Symbol;Acc:MGI:99179]

 
Come back to gene ENSMUSG00000063281


For any suggestions or comments, please send an email to unitrap@crg.es