Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST150050
Clone ID OST150050
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST150050
Sequence
GAACTGAGGTCCCACCCAGGAAGTGANGGCANGCTGCTCTGGNTGCTCTTTGTGATCCTCATCCTCACCAGTGGCTCCCA
CTGCTCACTGCCCCCCTCACCTCCCTTCAGGATGCAGCGACACGTANATGCCATCTTCACCACCAACTACAGGAAACTCC
TGAGCCAGCTGTATGCCCGGAAAGTGATCCAGGACATCATGAACAAGCAAGGGGAGAGGATCCAGGAACAAAGGGCCAGG
CTCAGCCGCCAGGAAGACAGCATGTGGACAGAGGACAAGCAGATGACCCTGGAGAGCATCTTGC
Sequence Type mRNA
Unitrap ID UNI25921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157157515..157159530 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027643 (Ghrh) NM_010285 growth hormone releasing hormone Gene [Source:MGI (curated);Acc:Ghrh-001]

 
Come back to gene ENSMUSG00000027643


For any suggestions or comments, please send an email to unitrap@crg.es