Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRU643
Clone ID RRU643
Vector pGT0Lxf
Project baygenomics

Sequence tag RRU643
Sequence
CTTGCCATAAAGCTACAGCCTTTTATCATATTTATTGATGAAATAGACTCTTTCCTACGAAATCGTTCCAGTTCTGACCA
CGAAGCTACAGCGATGATGAAAGCTCAGTTTATGAGTCTCTGGGATGGACTGGACACTGATCACAGCTGCCAGGTTATAG
TAATGGGAGCTACCAATCGCCCTCAAGACCTTGACTCCGCTATAATGCGAAGAATGCCTACACGATTTCATATTAACCAC
GCCT
Sequence Type mRNA
Unitrap ID UNI7225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32761723..32772975 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013662 (Atad1) NM_026487 ATPase family, AAA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915229]

 
Come back to gene ENSMUSG00000013662


For any suggestions or comments, please send an email to unitrap@crg.es