Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST149916
Clone ID OST149916
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST149916
Sequence
CAAATTGTGATGAATTGCGCTGATATTGACATTATTACAGCTTCATATGCCCCAGAAGGAGATGAAGAAATCCATGCGAC
AGGATTTAACTATCAGAATGAAGATGAGAAAGTCACCTTGTCTTTTCCTAGCACTCTGCAAACAGGTAANAAACATGCCT
TTTGTGAGATCCTATGAGGGAGAAAGCAGCTTACTGTTCCAAAGAAATTATCCCATTTTTTCCACTATTATTGCATGCAG
ATTAAAACGTTAAGAGCTTTTCTTTCCCCTTAAAAATTCTGAATTATGAAAATAAACATTTCAAATTTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI8107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97119424..97128975 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001441 (Npepps) NM_008942 aminopeptidase puromycin sensitive Gene [Source:MGI (curated);Acc:Npepps-001]

 
Come back to gene ENSMUSG00000001441


For any suggestions or comments, please send an email to unitrap@crg.es