Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST149784
Clone ID OST149784
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST149784
Sequence
GACTGAGGTGGGACTTCCCAGGANNCAGCANGCTCTCCACNATANNAGCCANGNGNAGGATCNGACATGACAGNNNAACT
ACNGAAAGCNATGCTACANGGAAGCAGTANACATTNAACANATGTTGCAANAGACNTTNCTCNCTANGAGNGGGACTGGC
TGAATCCTGCTCATAGGAGNTNGTACAGGACTGTGGNCGCTGGAGAACTACCGGAACTTGGTCTCTGTGNNANCTTGCAT
TTCCAAACCATCTCTAATCTCCTTATTGGAACATGGGAAGGAGCCTTGGGAGGTGAAGGGTCAGGTGACAGGAAGCAGAG
TACAAGGTGAGAAGTCANGAAGCAGATTGAAAACCGTTTCTAGGGAATGGCTCTGNCATCTATCTTCAGAGGTCCTTACC
TGGGCTGAGGCTGCCCAAAAAACTCTTCCTAAGCCTTGC
Sequence Type mRNA
Unitrap ID UNI25943

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6324011..6328436 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055150 (Zfp78) NM_177888 zinc finger protein 78 Gene [Source:MGI Symbol;Acc:MGI:107783]

 
Come back to gene ENSMUSG00000055150


For any suggestions or comments, please send an email to unitrap@crg.es