Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT116
Clone ID RRT116
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT116
Sequence
GATAGATGCAATTCACCAGCTGGGCTTCATCCACCGGGACGTCAAACCAGACAACCTTTTACTGGATGCCAAGGGACATG
TAAAATTATCTGATTTTGGTTTGTGCACGGGGTTAAAGAAAGCTCACAGGACTGAATTCTACAGAAACCTCACACATAAC
CCGCCAAGCGACTTCTCATTTCAGAACATGAATTCAAAGCGGAAAGCAGATACATGGAAGATGAACAGGAGACAGCT
Sequence Type mRNA
Unitrap ID UNI7238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146716937..146717677 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001630 (Stk38l) NM_172734 serine/threonine kinase 38 like Gene [Source:MGI (curated);Acc:Stk38l-001]

 
Come back to gene ENSMUSG00000001630


For any suggestions or comments, please send an email to unitrap@crg.es