Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST149556
Clone ID OST149556
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST149556
Sequence
CACTGTCTCACACCAGTATCCTGAGCTGCAATGGGACTGGGCAGNCACTGCCCNCTGGATGTCCTCCGCCCTGNCAAGCA
GATAGGGCGGTAGCTACCCCAGGAGTATCTGCCCCCTCTCAGCCTGGACCAGCCCTTTNTGGACTTGGTGGCCACCTTTG
CTGACCTAAGGCCATGTA
Sequence Type mRNA
Unitrap ID UNI14978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113279233..113279408 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es