Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT133
Clone ID RRT133
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT133
Sequence
CGCCTCCATCAACCCTTTGAATGACCACTGGACTCTGCGAGATGGGGCTGCCCTTCTACTCAGTCACATATTCTGGACGC
ATGGAGACCTTGTAAGTGGCCTGTATCAGCAGATTCTGCTGTCCCTGCAGAAGGTCCTGACAGACCCTGTTCGGCCTCTC
TGTTCTCACTATGGGGCAGTGGTGGGGCTGCATGCTCTAGGCTGGA
Sequence Type mRNA
Unitrap ID UNI7245

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8852579..8853077 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003680 (Taf6l) NM_146092 TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor Gene [Source:MGI Symbol;Acc:MGI:2444957]

 
Come back to gene ENSMUSG00000003680


For any suggestions or comments, please send an email to unitrap@crg.es