Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT152
Clone ID RRT152
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT152
Sequence
TGAGGGAGCATCTAGAGAACCCGCGCCTTCCCCCTCCGCAGGAGAGGAGGCAAGAGTGCGGAAAGCCAGGCCTGTCGGCC
TCCCTCCCACTTGTTCCTCTTGCTCCTCGTCCTTGGCAAGCCAGAGTTCTTCATTTCTAGGACTTAACACCCGTCTACTC
CCTTGACCTCTTCTGGTCTCTTGGCTGCAGCCATGGAGTTACAGAAGGGAAAGGGGACCGTAGCAGCTGCTGCATCAGGA
GCAGCGGGAGGTGGAGGAGGAGGAGCGGGAGCAGGAGCCCCAGGAGGGGGGAGGCTGCTACTTTCAACCAGTTTGGATGC
CAAGGATGAGTTAGAGG
Sequence Type mRNA
Unitrap ID UNI6642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90236728..90237064 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es