Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST149296
Clone ID OST149296
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST149296
Sequence
TGAGATATGGTCCAGTACTACCCATGAGTCAGTTTGGCTGGAGCTCGTGAGCATTCAATAATGAGTGGTGCGGCTTTAGG
ACTTGAGATTGTTTTTGTCTTTTTTCTGGCATTGTTCCTCCTGCATCGCTATGGAGACTTTAAGAAACAGCACAGACTGG
TAATCATCGGCACACTGCTTGCTTGGTGTCTCTGCTTTCTCATTGTCTTCATACTGCCGCTGGATGTCAGTACGACAATA
TATAACCGATGCAGGCATGCTGCTGCAAATTCCAGCCCTCCTGAAAATACCAACGTTACGGGACTGGATGCATCTGTCAC
TCCAGCTCCAAGACAGCATCCATGTTTCAAGCCGTGGAGTTACATTCCAGATGGAATCATGCCAATTTTCTGGAGGGTAG
TTTATTGGACATCACAGTTTTTGACGTGGATCCTGTNACCTTTTATGCAGTCATATGCAAGAATCTGGAGGTTTCTCCCT
CACCGGCAAGAAANAAACAGCCCCTGATTGA
Sequence Type mRNA
Unitrap ID UNI22938

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9078730..9086042 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039704 (Lmbrd2) NM_177178 LMBR1 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444173]

 
Come back to gene ENSMUSG00000039704


For any suggestions or comments, please send an email to unitrap@crg.es