Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST148940
Clone ID OST148940
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST148940
Sequence
GACTGAGGTGAACCAGGGGGAGAAGAGTCTCCCCACAACTTTGAATTCCACTTGCCCTTATCTCCAGAGGAGCTGCTGAA
AAGTGGAGGTGTGAATCAGTACGTTGTCCGGGAGGTGCTGCCCGTCAAGCACCTCTCATCCCAGCTTAGAGCATTTCAGT
CTGCCTTCCGAGCTCAGGGGCCCCTCGCCATACTGGAGCACTTCGATACAGTCTACAGCATTTTACATCACTTTCGAAGT
ATAGAACCTGGCCTCAAGGAAGACACTCTGGAATTCCTGAAGAAAGGGGAATCCNNCNNNTNCCAGGAACTGNNGACCAT
CCTGNANGATGCACCTCTGAGTGNATCAANATAGAAGCNCCCACCTGAATGCCCTCAAAATGAACTGCTATGCCCTGATA
CGCCTTTCTTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 125136180..125139928 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038252 (Ncapd2) NM_146171 non-SMC condensin I complex, subunit D2 Gene [Source:MGI Symbol;Acc:MGI:1915548]

 
Come back to gene ENSMUSG00000038252


For any suggestions or comments, please send an email to unitrap@crg.es