Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT219
Clone ID RRT219
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT219
Sequence
AGCATAAACGGGACAAGCACAAAGATGGAAGTGGAGACAGAGGGGAAAAGGACGCAAGCAAAATCACCACCTACCCTCCA
GGCTCTGTGAGGTTTGACTGTGAGCTCCGAGCAGTACAAGTCAGCTGTGGATTTCACCACTCAGTGGTTCTCATGGAAAA
CGGAGACGTCTATACCTTTGGATATGGGCAGCACGGCCAGCTGGGACATGGGGATGTCAATTCCAGGGGATGCCCCACTC
TTGTCCAAGCCTTGCCAGGCCCTAGCACACAAGTCACTGCCGGCAGCAACCACACGGCAGTCCTTTTAATGGATGGACAG
GTCTTCACATTTGGAAGTTTTTCT
Sequence Type mRNA
Unitrap ID UNI7261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 103651626..103668598 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033004 (Mycbp2) NP_997098 MYC binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2179432]

 
Come back to gene ENSMUSG00000033004


For any suggestions or comments, please send an email to unitrap@crg.es