Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST148679
Clone ID OST148679
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST148679
Sequence
GAGCTGGATATCAAGAAGAATGAGCGATTATGGCTCCTGGATGACTCTAAATCCTGGTGGCAGAGTTCGAAATTCCATGA
ATAAAACAGGTTTTGTCCCTTCTAACTATGTGGGAAAGAAAAAACAGTGCTCGGAAAGCATCTATTGTTAAAAACCTGAA
GGACACCTTAGGTATTGGAAAAGTGAAAAGAAAACCCAGTGTTCCAGATACTGCATCTCCTGCTGATGATAGCTTTGTTG
ATCCAGGAGAACGTCTCTATGACCTTAACATGCCTGCTTTTGTGAAATTTAACTACATGGCTGAGAGAGAGGATGAGTTG
TCATTGATAAAAGGGACCAAGGTGATCGTCATGGAGAAATGCANTGATGGATGGTGGCGTGGCANCTNCCACCGGACAAA
TTGGATGGTTTCCTTCAAACTATGTAACTGAAGAAGG
Sequence Type mRNA
Unitrap ID UNI19122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 100398125..100409016 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032475 (Nck1) NM_010878 non-catalytic region of tyrosine kinase adaptor protein 1 Gene [Source:MGI (curated);Acc:Nck1-001]

 
Come back to gene ENSMUSG00000032475


For any suggestions or comments, please send an email to unitrap@crg.es