Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT235
Clone ID RRT235
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT235
Sequence
CGCACGGTCCAGCCCTCACCCGGGTTCCGCTACACTCGTGAACCTTAGCGCTCGATCCCGAACTAGCGGCCATGGCG
Sequence Type mRNA
Unitrap ID UNI7264

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 138106075..138106151 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028138 (Adh5) NM_007410 alcohol dehydrogenase 5 (class III), chi polypeptide Gene [Source:MGI (curated);Acc:Adh5]

 
Come back to gene ENSMUSG00000028138


For any suggestions or comments, please send an email to unitrap@crg.es