Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST148521
Clone ID OST148521
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST148521
Sequence
GACTGAGGTTATTAGCAAAAGATGGTGGATCGCCTGGCAAACAGTGAGGCGAATACTAGACGCATAAGTATTGTGGAGAG
CTGTTTTGGAGCCGCTGGTCAGCCCTTGACCATCCCTGGGCGAGTGCTTATTGGAGAAGGAGTGTTGACTAAGCTGTGTA
GAAAGAAGCCTAAAGCAAGGCAGTTTTTCTTATTTAATGATATTCTAGTATACGGCAATATTGTTATCCAGAAGAAAAAA
TACAACAAACAGCATATTATTCCCTTGGAAAATGTCACCATTGATTCCATCAAAGATGAAGGGGAATTACGGAATGGATG
GGCTTATTAAGACACCGACTAAGTCGTTTGCAGTTTATGCTGCCACTGCCACGGAGAAGTCAGAGTGGATGAATCACATA
AATAAGTGNGTCACTGATTTACTCTCCAAAAGTGGGGAAGACGCCCAGCAACGAGCATGCTGCTGTCTGGGTTCCTGACT
CTGAGGCCACCGTGNGTATGCGCTGTCAGAAAGCAAAATT
Sequence Type mRNA
Unitrap ID UNI428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 10917991..10918503 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049969 (Plekhf2) NM_175175 pleckstrin homology domain containing, family F (with FYVE domain) member 2 Gene [Source:MGI (curated);Acc:Plekhf2-001]

 
Come back to gene ENSMUSG00000049969


For any suggestions or comments, please send an email to unitrap@crg.es