Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST148479
Clone ID OST148479
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST148479
Sequence
TGACTCCTGAAACATGGCGACCAGCGCTGTTCCAAGTGAAAACCTTCCCACATATAAACTAGTAGTGGTGGGAGATGGTG
GTGTGGNCAAGAGTGCGCTCACTATTCAGTTTTTCCAGAAGATCTTTGTGCCTGACTACGACCCCACCATTGAAGACTCC
TACCTGAAGCATACAGAGATTGACAATCAGTGGGCCATCTTGGATGTTCTGGACACAGCCGNNCNGGAGGAGTTCAGTGC
CATGCGGGAACAATACATGCGCACAGGGGATGGCTTCCTCATTGTCTACTCCGTCACCGACAAGGCCAGCTTCGAGCACG
TGGACCGCTTCCACCAGCTCATTCTGCGTGTCAAGGACAGGGAGTCATTCCCAATGATCCTCGTGGCCAACAAGGTGGAT
CTGATGCACCTAAGGAAAGTCACCAGGGACCAAGGAAAAGAAATGGCAACCCAAATNCNATATCCCATATATAGAGACCA
G
Sequence Type mRNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99290212..99312018 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es