Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST148451
Clone ID OST148451
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST148451
Sequence
TGAGAACCCAGCAGTGATGTGGAGGTGGAGNCTCACGGGAGCCCCGGACTTCACCTGAGCTACCTCAGTCGCCAAGAGTG
GCAAGAANNGGAAGAAGACCCTGACTTGGGGGGGACCAGGATGCCTGACCGGGACAGCTATGCCAACGGCACTGGCAGCA
GCAGGTGGAGGCCCTGGAGGTGGTGGCAGTGAGGAGGCCAGTGGGGCAGGGACAGGCAGCGGGGGAGCCACCTNAGATGC
CATNTGTAGAGACTTCCTGAGGAACGTCTGCAAACGAGGAGTGTANCCGCCCCAACTGNCGNTACATCCACGGGTCCAAG
GAGGATGAGGATGGCTATAAGAAGACAGGAGAGCTGCCTCCCCCGTNTGAAAGCAGAAAGTGGCCGCTG
Sequence Type mRNA
Unitrap ID UNI20382

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127982179..127983949 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039810 (Zc3h10) NM_134003 zinc finger CCCH type containing 10 Gene [Source:MGI (curated);Acc:Zc3h10-001]

 
Come back to gene ENSMUSG00000039810


For any suggestions or comments, please send an email to unitrap@crg.es