Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT272
Clone ID RRT272
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT272
Sequence
GGCGTTGTGTGATCCGCAGCTGGCGCGGAAGCTTCAGGTGGCAAGCGATCGCTGCGGAAGATGTCGGACAGCGAAGACAG
CAACTTCTCCGAGGAGGAGGACAGCGAGCGCAGCAGCGAGGCGGACGAGGCCG
Sequence Type mRNA
Unitrap ID UNI7268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29123373..29123764 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003435 (Supt5h) NM_013676 suppressor of Ty 5 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1202400]

 
Come back to gene ENSMUSG00000003435


For any suggestions or comments, please send an email to unitrap@crg.es