Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST148198
Clone ID OST148198
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST148198
Sequence
CTGGTACCAATTGGCAAGCCGGCCTCAGAGCACTACGATGATGAGGAAGAAGAGGATGATGA
Sequence Type mRNA
Unitrap ID UNI20618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109047098..109047445 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030649 (3200002M19Rik) NM_027532 RIKEN cDNA 3200002M19 gene Gene [Source:MGI Symbol;Acc:MGI:1922680]

 
Come back to gene ENSMUSG00000030649


For any suggestions or comments, please send an email to unitrap@crg.es