Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DA0180
Clone ID DA0180
Vector pGT1lxr
Project sanger

Sequence tag DA0180
Sequence
CCTTTTCTCTTCATTCGCATCCAGCTTTCTACTCCTCGCCACCTTGACTTGCCTCTTTCCTCACCCACCTCGTCTTCGCG
CGGCGGCGGCGGTGGTGGAGACGGCTGAGGAGGATGTGGGCTACGCGCGGGCTGGCGGTAGCGCTGGCCCTGAGCGTGCT
GCCTGACAGCCGGGCGCTGCGGCCAGGAGACTGTGAAGTTTGTATTTCTTATCTGGGACGATTTTACCAGGACCTCAAAG
ACAGAGATGTCACATTTTCACCAGCCACTATTGAAGAAGAACTTATAAAGTTTTGCCGTGAAGCAAGAGGCAAAGAGAAT
CGGTTGTGCTACTACATTGGAGCCACAGATGATGCTGCCACCAAGATCATCAATGAGGTGTCGAAGCCCCTGGCCCACCA
TATCCCTGTGGAAAAGATCTGTGAGAAGCTGAAGAAGAAAGACAGCCAGATCTGTGAACTAAAATACG
Sequence Type mRNA
Unitrap ID UNI467

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106792492..106794268 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032575 (Armet) NM_029103 arginine-rich, mutated in early stage tumors Gene [Source:MGI Symbol;Acc:MGI:1922090]

 
Come back to gene ENSMUSG00000032575


For any suggestions or comments, please send an email to unitrap@crg.es