Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST147866
Clone ID OST147866
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST147866
Sequence
GACTGAGGTGAAAGGAGAGGCCAGGTCAGCCTTGACCAAGCCGAAGATAACCACAATAACTGTAAAAAAACCTCAAATGA
AGAAAAGCCAAAGCTGTCTATTGGCGAAGAATGCAGGGCAGATGAACAAGCCTTCTTAGNGGCCCTGTATAAATACATGA
AA
Sequence Type mRNA
Unitrap ID UNI3599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 67591586..67591743 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019947 (Arid5b) NM_023598 AT rich interactive domain 5B (MRF1-like) Gene [Source:MGI Symbol;Acc:MGI:2175912]

 
Come back to gene ENSMUSG00000019947


For any suggestions or comments, please send an email to unitrap@crg.es