Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST147525
Clone ID OST147525
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST147525
Sequence
AACTGAGATGACCAATGCAAGGGACAGCTCTCCACACTGCCCCCTGNNGGTACAGGCCCGGCTCTGCNTCTACCCCTACT
ACACAACTACCTGCTGCCGNTCTTGTGCCCATGTNCTGGAGCAGTCCCAGNTGGAACCGGCTTGAAACGGGTCCCAGAGA
CCCTGCCTTCGTGGTTTTCTTGTGCCACCCACTGACTAGCCCGCTCTGTACCCTNTGGCTTTTCACCTGGTCTCAGCCTT
GCCAGAGGGATCCTCCAGGGTGAGAGACCTACAGTGTGATAGCCCAAGAAGTGTACCTGACCTGCCTGGGGGTCTGGCCT
GTGTATGTTTATCACTTCCACAAAAGCAGCTTGAGAAAGAATAGGAAG
Sequence Type mRNA
Unitrap ID UNI26002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95480533..95480897 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015850 (Adamtsl4) NM_144899 ADAMTS-like 4 Gene [Source:MGI (curated);Acc:Adamtsl4-001]

 
Come back to gene ENSMUSG00000015850


For any suggestions or comments, please send an email to unitrap@crg.es