Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST147502
Clone ID OST147502
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST147502
Sequence
CGCAATACAACATCCAGAAGAAAGCCNTGACTGTGAAGGAGTTCAGGCAGCTGGCTAACAGCAGCAAATACTGTACTCCA
AGATACTTGGATTATGAAGATTTGGAACGCANATACTGGAAAAACTTAACTTTTGNGGCACCTATTTATGGAGCAGATAT
AAATGGGAGCATTTATGA
Sequence Type mRNA
Unitrap ID UNI1552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 73917207..73926911 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028397 (Jmjd2c) NM_144787 jumonji domain containing 2C Gene [Source:MGI (curated);Acc:Jmjd2c-006]

 
Come back to gene ENSMUSG00000028397


For any suggestions or comments, please send an email to unitrap@crg.es