Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST147380
Clone ID OST147380
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST147380
Sequence
ACTGAGGTAGAAGAATACATGTTTACCTTTAGTGAACAAGAGCATGTTCCCAAACTCAATTTTGGGTCGTCCACCCTTCA
CTCCAACCCACCAACAGCATAATAACTTCTTTGCTCTCTCACCAACTCTTTATTCACACCAGCAACTTATAGATGCACAA
TTCAACTTTCAAAATGTAGACTTGTCTAGAGCTGTGTCCTTACAGCCTCTGACATATGGAACTGTCAGTCCAATACAGAC
CTCAACATCTCCATTATTTCGAGGAAGGAAGAGAATAAGCGATGAAAAAGCTTTTCCTCTTGATGGTAAACGGCAGCGTT
TCCATTCACCCCACCAAGAGCCAACTATAATCAACCAGCTAGTGCCTTTATCAGGTGACAGAAGATATTCCATTGCCACC
GNTGTTTCACACGCACTATATACCAGATATAGTCAGATGTGTNCCACCTCTTCGAGAAATTCCACTGTTAGAACCTCGAG
AAATCACACTG
Sequence Type mRNA
Unitrap ID UNI2225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 93954052..93956433 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042167 (Papd4) NM_133905 PAP associated domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2140950]

 
Come back to gene ENSMUSG00000042167


For any suggestions or comments, please send an email to unitrap@crg.es