Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT618
Clone ID RRT618
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT618
Sequence
AAGATGTCTCAGAAAGAACTGCTAGGCCCGTCAGAGGCAAAGAAGGCCAAAGGCCCTGAAGAAGAATCAACTGGGAGCCC
TGAGTCTACAGCAGCTCCAGCGTCTGCCTCCCAGAAACTAAGCCTCTTACAGAAGCTAAGCAATATGGATCCAGCCATGT
TGGAGAACCTCCTGAGTATGGAACGTTTGCTGGGTTCCCAGGGAAGCCAAGGGACCCCCCTACTGAATACCCCAAAGCGA
GAACGAATGGTGCTCATGAAGACAGTGGAGGAAAAGAACTTAGAGATTG
Sequence Type mRNA
Unitrap ID UNI7287

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134174445..134176264 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es