Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT428
Clone ID RRT428
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT428
Sequence
GGCGGAGCGATCTGCGCCGCAGAATTTTCCCCAGAGAATATCTCCTTCAACAGATCCACCTGTACTCTCTCGTTGACCTG
CAG
Sequence Type mRNA
Unitrap ID UNI7297

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 64907764..64907827 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051344 (Plekhm1l) NM_001039493 pleckstrin homology domain containing, family M, member 3 Gene [Source:MGI (curated);Acc:Plekhm1l-001]

 
Come back to gene ENSMUSG00000051344


For any suggestions or comments, please send an email to unitrap@crg.es