Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST146908
Clone ID OST146908
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST146908
Sequence
GACTGAGTTAAGGAGGAGATCTCCCGGNGGTTTAAGGCTCAGCAGGATCAGCTGGTCCTGATCTTCGCAGGCAAGATCCT
CAAGGATGGGGACACCCTGAGCCAGCACGGCATCAAGGATGGGCTCACAGTCCACCTAGTCATCAAAACCCCTCAGAAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI22257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87566922..88359411 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es