Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST146638
Clone ID OST146638
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST146638
Sequence
TGAGACCTCTCCAGCATCAACCAGACCCGGCTCGAGTTCCACTTCTCTGGTAGAATGGCCAGCGGCATGGAGGTCCGGCA
GACCCGCTTCATGTTCTTCGTACAGTTCCCCCACAATGCCACCCAGACCATGAATATAANAGTTCTTGTGCTAAGACCAT
ATCGA
Sequence Type mRNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126794728..126794887 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es