Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST146533
Clone ID OST146533
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST146533
Sequence
GACTGAGGTTGCAGAAAACCCTCACTCTGAGTACGGGCTCACAGACAGCGTTGAGAGAATAGTCNAAAATGAGAAGATTA
ATGCAGAAAAGTCATCTGAAACAGANGGTGGATCTACAGTCCTTGCCCACCCGTGCCTACCTGGACCAGACAGTTGTGCC
TATCTTATTACAGGGACTTGCTGTGCTTGCCAAGGAAAGACCACCAAATCCCATCGAGTTCCTAGCATNTTATCTTTTAA
AAAACANGGCGCAGTTTGAAGATCGAAATTGATTTCTTGGGAAGAGAAGAAACATTTGGTTGCTACTGTAGATTTACATG
ATTACGAGGCAGCTTTAATTGCCATGATTCCCCTCCCCACTCTGGACGCCTAAGAACCTTCAGGACCACAGACCTCACTT
CTGGAGTTGCAGAAGAGAGCATATCCCTGTCTGATTTAATCACCATACTTATTTAATGAGTATCATCTGTGCAATTTTTT
TCTCAGATTGTCTTTTACTTTGNTTTTAAAAAGACCTTCAAAATAAA
Sequence Type mRNA
Unitrap ID UNI26008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74698837..74715291 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es