Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST146351
Clone ID OST146351
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST146351
Sequence
ACCCACTGCCACCCAGGAAGAATTGAAAAAGGCNTATAGAAAATTGGCCTTGAAGTACCACCCTGATAAGAATCCAAATG
AAGGGGAAAAGTTTAAACAGATTTCTCAAGCTTATGAAGTTCTTGCTGATTCCAAAAAAAGGGAACTATATGATAAAGGA
GGGGAGCAGGCGATTAAAGAGGGCGGGAGCAGGTGGTGGTTTTGGCTCACCCATGGATATCTTTGATATGTTCTTTGGAG
GAGGAGGAAGAATGCAAAGAGAAAGGAGAGGTAAAAATGTTGTTCATTCAGCTCTCAGTGACCTTAGAAGACTTATATAA
TGGTGCAACAAGAAAACTGGCTCTGCAAAAGAATGTGATTTGTGACAAATGTGAAGGCCGAGGTGGTAAGAAAGGAGCAG
NANAGTGCTGNCCCAACTGCCGGGGGGACCAGGTATGCA
Sequence Type mRNA
Unitrap ID UNI17093

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40670787..40675049 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028410 (Dnaja1) NM_008298 DnaJ (Hsp40) homolog, subfamily A, member 1 Gene [Source:MGI (curated);Acc:Dnaja1-001]

 
Come back to gene ENSMUSG00000028410


For any suggestions or comments, please send an email to unitrap@crg.es