Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT661
Clone ID RRT661
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT661
Sequence
GAGCAGTTCGTGGTTTAGGTTTTGGGCTGCAGTCTGGGTCTGAAGGCGGCCGGAGCGGCTGTCTCAATTACGATGAGGCT
CCTGCTGCTTCTGCTGGTGGCGGCGTCGGCGGTGGTCCGCAGCGAGGCCTCTGCCAACCTGGGCGGCGTGCCCAGCAAGA
GATTAAAGATGCAGTACGCCACCGGGCCGCTGCTCAAGTTCCAGATTT
Sequence Type mRNA
Unitrap ID UNI7301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58380588..58380794 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075700 (2810407C02Rik) NM_001040396 RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

 
Come back to gene ENSMUSG00000075700


For any suggestions or comments, please send an email to unitrap@crg.es