Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST146253
Clone ID OST146253
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST146253
Sequence
AGACTGAGGTAAGAGTAACAAGAGGATGAATGCTTCTCTCCTAAATGTTCCTCAGGGTCAGTTAACATTCAAGGATGTGG
CAGTGGACTTCTCACAGGAGGAATGGGAATGTCTTGATTGTGCTCAGAGGGCACTGTACATGGATGTGATGTTGGAGAAT
TACAATAATCTGTTTTTTGTGGAGACCCATGGGATGTGTCCTAAATATANGAACNTNTTGGATCAANACCTTNATCATAT
TGCCCATGA
Sequence Type mRNA
Unitrap ID UNI26011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21958037..21960860 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069743 (Zfp820) NP_083557 zinc finger protein 820 Gene [Source:MGI Symbol;Acc:MGI:1922674]

 
Come back to gene ENSMUSG00000069743


For any suggestions or comments, please send an email to unitrap@crg.es