Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST146166
Clone ID OST146166
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST146166
Sequence
GACTGAGACATAAAATCGCCGGCTCGTTTCTGCCCTTTTTGGATGAGGATCGTCTGGAAGATCTGGNAGTAAGTTCCTTG
GAGGAGAGGAAGAAGATGATANAATGTATCCAGCAGCTGAGTCAGTCTCGGATTGATCTAATGAAGGTATTTANTGATCC
CATTCATGNCCACATTGAGNTCCACCCTCTCCTTATCAGAATCATCGACACACCNNANNTCCAGCGACTTTTTNTATATN
AGGCGGCTGGGGGGCGGCTACTATGTTTTCCCTGGAGCGTCCCACAATCGCTTCAAACACAGTCTCGGAGTGGGGTACCT
AGCANGCTGCCTGGTGCGAGCACTTGCCGAAAAACAGCCAGAGCTACAGATCAGTGAGCGAGATATACTCTGTGTTCAGA
TTGCGGNGCTCTGCCACGACCTAGGTCATGGNCCATTTTCTCATATGT
Sequence Type mRNA
Unitrap ID UNI26012

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156946265..156955654 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027639 (Samhd1) NM_018851 SAM domain and HD domain, 1 Gene [Source:MGI (curated);Acc:Samhd1-001]

 
Come back to gene ENSMUSG00000027639


For any suggestions or comments, please send an email to unitrap@crg.es