Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST146025
Clone ID OST146025
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST146025
Sequence
CTCAAGGACCTAACTGNCTCTNNTCAANTACANNGANGCTGCCNTGAGCANTGCTCTCAGNGAGAAGCGCACATTGGAGG
GCGAGCTCCATGACCTGCGGGGGCAGGTAGCCAAGCTTGAGGCGGCCCTGGGAGAGGCTAAGAAGCAGCTTCAGGATGAG
ATGCTGAGGCGAGTGGATGCTGAGAACAGGCTACAGACGCTGAAGGAGGAGCTTGACTTCCAGAAGAACATTTACAGCGA
GGAACTGCGTGAGACCAAGCGCCGGCATGAGACGCGGCTTGTGGAGATCGATAACCGGGAAGCAGCGAGAGTTTGAGAGC
CGGCTGGCAGATGCCCTGCAGGAGCTGCGGGCTCAGCATGAGGACCAGGTGGAACAGTATAAGAAGGAGCTAGAAAAGAC
ATACTCCGCCAAGCTGGATAATGCCAGGCAGNCTGCTGAGAGGAACAGNAACCTNGNGGGGGCTGCCCATGAGGAACTGA
Sequence Type mRNA
Unitrap ID UNI14233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88290186..88292310 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es