Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST145856
Clone ID OST145856
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST145856
Sequence
GACTGAGGGTCCGCCCCAAAGAGTATGAGCCTCTGAGATGGAGACTTCTGCCCCAGCCCCTGCACTGGAGAAGAAAGAAG
CCANGAGTGGTCTCTTGGAGGACAGCAGCTTCCCCGACCCAGGGAAAAAGGCCTGTCCTCTGGCGGTGGCCGCAGCTGTA
GCCGCCCAAGGAGGGTGTCGGTGGTCACAGGCACTGTCTTCAAACATNCACGCCAAGGCAGGACTGGGCTNNNANCCGAN
GGGGGNGGCTTCCTCATAAAGATTGGGCAAACGGCTGCGTGGGGGCTAAACTGGTAATGNGGTGCTGNGNGTTCTAACTT
CCTTTTCTGNTGCTGGGATTAAAAACTGAAT
Sequence Type mRNA
Unitrap ID UNI9266

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 120828811..120898785 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048402 (Gli2) NM_001081125 GLI-Kruppel family member GLI2 Gene [Source:MGI Symbol;Acc:MGI:95728]

 
Come back to gene ENSMUSG00000048402


For any suggestions or comments, please send an email to unitrap@crg.es