Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT484
Clone ID RRT484
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT484
Sequence
TTCGGTTTACCAAGGAGATAAAAGGCCTGAAGGTGGAAGTGACCCACTGTGGACAGATGAAGAGGAAATACCGCGTGTGT
AATGTTACCCGCCGCCCTGCTAGCCATCAGACGTTCCCCTTGCAGCTGGAGAGTGGACAGACTGTGGAGTGCACTGTGGC
ACAGTATTTCAAGCAGAAATATAACCTTCAGCTCAAGTATCCTCACCTGCCCTGCCTACAAGTTGGGCAAGAACAGAAGC
ATACCTATTTGCCCCTCGAGGTCTGTAACATTGTGGCTGGGCAGCGGTGCATTAAGAAGCTGACTGACAACCAGACTTCA
ACCATGATAAAGGCTACAGCTAGGTCGGCCCCAGACAGACAGGAGGAGATCAGCCGCCT
Sequence Type mRNA
Unitrap ID UNI7306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126131550..126137268 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es