Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST145741
Clone ID OST145741
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST145741
Sequence
GACTGAGACTCAGCAGAGGCTGAGTAAGATGAGCTCCCTCCTGGAACGGCTCCATGCAAAATTTAACCAGAACAGACCTT
GGAGTGAAACCATTAAGCTTGTGCGTCAAGTAATGGAGAAGAGGGTCGTAATGAGTTCTGGAGGGCATCAGCATTTGGTC
AGCTGTTTGGAGACATTGCAGAAGGCTCTCAAAGTAACATCTTTGCCAGCAATGACTGATCGTTTGGAATCTATAGCCAG
ACAGAATGGACTGGGCTCTCACCTCAGTGCCAGTGGCACTGAGTGTTACATCACGTCAGATATGTTCTATGTGGAAGTGC
ANNTAGATCCTGCAGGACAGCTTTG
Sequence Type mRNA
Unitrap ID UNI22196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98041368..98050604 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018160 (Med1) NM_001080118 methyl-CpG binding domain protein 4 Gene [Source:MGI (curated);Acc:Med1-004]

 
Come back to gene ENSMUSG00000018160


For any suggestions or comments, please send an email to unitrap@crg.es