Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST145492
Clone ID OST145492
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST145492
Sequence
GACTGAGGAGGAAGTGAACATCCCTAGCCGGCGGGTTCTCATTACTGGTGCCACTGGGCTTCTTGGCAGAGCAGTTTACA
AAGAGTTTCAGCAGAGCAACTGGCACACCGTTGGCTGTGGCTTTCGAAGAGCAAGACCAAAATTCGAACAAGTGAACCTN
GTTGGATTCTGAAGCTGTTCATCACCTCATTCATGATTTCCAGCCTCATGNCATAGTGCATTGNGCTGCAGAGAGAAGAC
CTGATGTTGTTGAGAGTCAGCCAGATGCTGCTTCCCAGCTGAATGNGGGTGCCTCTGGGAACTTGGCAAAGGAGGCAGCT
GCGATTGGAGCATTTCTCATCTACATTAGCTCAGATTATGTGNTTGATGGCACAAATCCCCCTTACACAGAAGAAGATAT
ACCAAGTCCCCTGAATCTATATGGAAAANCAAAATTAGATGGAGAAAAAGCAGNCCTGGAGAATAATTTA
Sequence Type mRNA
Unitrap ID UNI23269

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40498185..40501299 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]

 
Come back to gene ENSMUSG00000042032


For any suggestions or comments, please send an email to unitrap@crg.es