Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST145455
Clone ID OST145455
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST145455
Sequence
GACTGAGGAGGTGTGCCTAGTGAGGCCCGGCAGTGTGACTACACGGGCCAATACTACTGCAGCCACTGCCACTGGAACGA
CCTGGCTGTCATCCCCGCGAGAGTGGTGCACAACTGGGACTTTGAGCCACGCAAGGTGTCCCGTTGCAGCATGCGCTACC
TGGCACTGATGGTGTCTCGGCCAGTGCTCAGGCTCCGGGAGATTAACCCTTTGCTGTTTAACTACGTGGAAGAGCTGGTG
GAGATCCGGAAACTGCGCCAGGACATCCTGCTCATGAAGCCATACTTCATCACCTGCAAGGAGGCCATGGAGGCGCGACT
ACTGCTGCAGGTCAGACTGCTAGAGGGACCAGTCCGGGGTGTACTTCATACTCAGATTCCTCAGATAACCCTGTAGTTCG
TCGATACATTGTTACTTCTAGCCGCAGTTTGAGCGCAG
Sequence Type mRNA
Unitrap ID UNI26019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125980304..125982435 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001482 (Def8) NM_054046 differentially expressed in FDCP 8 Gene [Source:MGI (curated);Acc:Def8-003]

 
Come back to gene ENSMUSG00000001482


For any suggestions or comments, please send an email to unitrap@crg.es