Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST145335
Clone ID OST145335
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST145335
Sequence
GACTGAGTGGAGCGCAGAAGAGCCGAGGAGAGTGGAATTGCAGATGTCTAGTCAACCAAGCACGGCTCCTGCAAAGGCTA
AAGCAACGGGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16649

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48287989..48288088 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058550 (Dppa4) NM_001018002 developmental pluripotency associated 4 Gene [Source:MGI Symbol;Acc:MGI:2157525]

 
Come back to gene ENSMUSG00000058550


For any suggestions or comments, please send an email to unitrap@crg.es