Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST145227
Clone ID OST145227
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST145227
Sequence
GACTGAGGTGTCTGCCTGGCTCAAGATCTCCCAAAAACTCTGCTGCAGAAATCCCAGTAACTAGTAATGGAGAAGTTGAC
GATGCTCATGAGCATGGCTACAATAGGGATTTGAAGCATTCATTACCATCTGGACTTGGACTCTCAGAAACTCAGATCAC
ATCTCATGGCTTTGACAGTACCAAAGAGGGGGTTACTGAAGCAGGAGCACCCCAAGGATGNNGNCCANNCCCTNNNCNAG
GANGTGCNCTGCCACTCATGCACGGCCTC
Sequence Type mRNA
Unitrap ID UNI16295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84338234..84351959 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074513 (Arfip1) NM_001081093 ADP-ribosylation factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1277120]

 
Come back to gene ENSMUSG00000074513


For any suggestions or comments, please send an email to unitrap@crg.es