Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRT555
Clone ID RRT555
Vector pGT0Lxf
Project baygenomics

Sequence tag RRT555
Sequence
TTGCTAAAGCTCCAAGAGGAAGTGGTTAGGAAGATCCGCTCTAACCAGCAGCTGGAGCAGGACCTCAACCTCATGGACAT
CAAGATTAATCTGCTCGTCAAGAACCGCATCACCCTGCAGGTCCCAAAAGG
Sequence Type mRNA
Unitrap ID UNI7313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87911523..87911644 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028068 (Iqgap3) NM_001033484 IQ motif containing GTPase activating protein 3 Gene [Source:MGI Symbol;Acc:MGI:3028642]

 
Come back to gene ENSMUSG00000028068


For any suggestions or comments, please send an email to unitrap@crg.es